Add a new SARS-CoV-2 visualisation data sample set
See original GitHub issueNot entirely sure if it’s possible, but I think mapping out the SARS-CoV-2 DNA sequencing would be something to be able to do and may open up Constellation to different fields that may not have looked at it previously.
I’ve downloaded the SARS-CoV-2 genome (from here I believe https://genexa.ch/sars2-bioinformatics-resources/) but it’s only the ACGT type data for the nucleotides(?)
>NC_045512 |Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1| complete genome
ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCT
GTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACT
CACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAGTAACTCGTCTATC
TTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTT
CGTCCGGGTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAAC
etc
I’m not entirely sure where the spatial data for constellation is as in how the spatial information for the parts of the dna that fold back on itself and forms the ‘spike’ for the ACE-2 receptor but being able to get that information from somewhere would allow a pretty cool default data set to have and to be able to display in 3d (something that looks a bit like this: https://cdn.geekwire.com/wp-content/uploads/2020/02/200219-cov19-1-630x344.jpg)
Issue Analytics
- State:
- Created 3 years ago
- Comments:9 (1 by maintainers)
Top GitHub Comments
Constellation_covid19_spike_glycoprotein.zip I’ve attached the star graph and a 10sec video panning around the protein