question-mark
Stuck on an issue?

Lightrun Answers was designed to reduce the constant googling that comes with debugging 3rd party libraries. It collects links to all the places you might be looking at while hunting down a tough bug.

And, if you’re still stuck at the end, we’re happy to hop on a call to see how we can help out.

Add a new SARS-CoV-2 visualisation data sample set

See original GitHub issue

Not entirely sure if it’s possible, but I think mapping out the SARS-CoV-2 DNA sequencing would be something to be able to do and may open up Constellation to different fields that may not have looked at it previously.

I’ve downloaded the SARS-CoV-2 genome (from here I believe https://genexa.ch/sars2-bioinformatics-resources/) but it’s only the ACGT type data for the nucleotides(?)

>NC_045512 |Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1| complete genome
ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCT
GTTCTCTAAACGAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACT
CACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAGTAACTCGTCTATC
TTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTT
CGTCCGGGTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAAC

etc

I’m not entirely sure where the spatial data for constellation is as in how the spatial information for the parts of the dna that fold back on itself and forms the ‘spike’ for the ACE-2 receptor but being able to get that information from somewhere would allow a pretty cool default data set to have and to be able to display in 3d (something that looks a bit like this: https://cdn.geekwire.com/wp-content/uploads/2020/02/200219-cov19-1-630x344.jpg)

Issue Analytics

  • State:closed
  • Created 3 years ago
  • Comments:9 (1 by maintainers)

github_iconTop GitHub Comments

3reactions
Guilty-Spark-343commented, Apr 30, 2020

Constellation_covid19_spike_glycoprotein.zip I’ve attached the star graph and a 10sec video panning around the protein

3reactions
Guilty-Spark-343commented, Apr 30, 2020

COVID19_spike_snap

Read more comments on GitHub >

github_iconTop Results From Across the Web

An interactive visualization of COVID-19 | 91-DIVOC
Generate detailed data reports based off the visualization you create. View all the graphs below or each graph individually: by countries, by US...
Read more >
COVID-19 Data Hub - Tableau
Access the latest solutions and resources from data leaders around the world and find datasets and starter workbooks to create your own analyses....
Read more >
Data visualization with Coronavirus Datasets from Kaggle
First, create a new database in Local named 'Corona'. Name the tables 'confirmed_df', 'deaths_df', and 'recoveries_df' respectively. As ...
Read more >
COVID-19 tracking sample for US state and local governments
The Power BI team has created a COVID-19 tracking sample that enables US state and local governments to publish or customize an interactive ......
Read more >
A New Interactive Tool to Visualize and Analyze COVID-19 Data
An important core of this work is to create a comprehensive repository of data, tools, models, and interactive systems that can be used...
Read more >

github_iconTop Related Medium Post

No results found

github_iconTop Related StackOverflow Question

No results found

github_iconTroubleshoot Live Code

Lightrun enables developers to add logs, metrics and snapshots to live code - no restarts or redeploys required.
Start Free

github_iconTop Related Reddit Thread

No results found

github_iconTop Related Hackernoon Post

No results found

github_iconTop Related Tweet

No results found

github_iconTop Related Dev.to Post

No results found

github_iconTop Related Hashnode Post

No results found