Stuck on an issue?

Lightrun Answers was designed to reduce the constant googling that comes with debugging 3rd party libraries. It collects links to all the places you might be looking at while hunting down a tough bug.

And, if you’re still stuck at the end, we’re happy to hop on a call to see how we can help out.

[BUG] Using pretty printers on BioSeq after translation results in an empty source sequence

See original GitHub issue

Describe the bug Using pretty printers on BioSeq results in an empty source sequence

To Reproduce

create BioSeq, pretty print it

#r "nuget: BioFSharp, 2.0.0-beta6"
#r "nuget: BioFSharp.IO, 2.0.0-beta6"

open BioFSharp
open BioFSharp.IO

let myGene = 
    BioSeq.ofNucleotideString "ATGGCTAGATCGATCGATCGGCTAACGTAA"
    |> BioSeq.complement
    |> BioSeq.transcribeTemplateStrand
    |> BioSeq.translate 0
  
myGene |> Seq.length //10
  
myGene |> FSIPrinters.prettyPrintBioCollection

myGene |> Seq.length //0

and investigate the original sequence afterwards

Expected behavior myGene stays the same after the printer

Additional information

BioArray works as expected, so the problem seems to lie in the intternals of BioSeq:

#r "nuget: BioFSharp, 2.0.0-beta6"
#r "nuget: BioFSharp.IO, 2.0.0-beta6"

open BioFSharp
open BioFSharp.IO

let myGene = 
    BioArray.ofNucleotideString "ATGGCTAGATCGATCGATCGGCTAACGTAA"
    |> BioArray.complement
    |> BioArray.transcribeTemplateStrand
    |> BioArray.translate 0
  
myGene.Length
  
myGene |> FSIPrinters.prettyPrintBioCollection

myGene.Length

Leaving out |> BioSeq.translate 0 also leaves things unaffected, so the problem seems to be in the translate function

Issue Analytics

State:
Created 2 years ago
Comments:5 (3 by maintainers)

Top GitHub Comments

1reaction

olegvolovodacommented, Jun 2, 2023

Without proper lab issue examination, it’s too early to make distinct statements about the ‘pretty print relativity’ effect. Although other data eliminating factors could be electrical and magnetic fields.

пт, 2 июн. 2023 г. в 14:20, Kevin Schneider @.***>:

That are a whole set of reasons bytes disappears. For now, evidence were received about quantum effects decrease data

size while pretty print state is measured.

u ok?

— Reply to this email directly, view it on GitHub https://github.com/CSBiology/BioFSharp/issues/122#issuecomment-1573573628, or unsubscribe https://github.com/notifications/unsubscribe-auth/AALGY4CXV7Y3JUXQWGZDQDDXJHD77ANCNFSM5ETV3GPA . You are receiving this because you commented.Message ID: @.***>

1reaction

olegvolovodacommented, Jun 2, 2023

That are a whole set of reasons bytes disappears. For now, evidence were received about quantum effects decrease data size while pretty print state is measured.

Top Results From Across the Web

Issues · CSBiology/BioFSharp

Open source bioinformatics and computational biology toolbox written in F#. ... [BUG] Using pretty printers on BioSeq after translation results in an empty...

Introduction to SeqIO

SeqIO provides a simple uniform interface to input and output assorted sequence file formats (including multiple sequence alignments), but will only deal with...

Biopython Tutorial and Cookbook

The actual biological transcription process works from the template strand, doing a reverse complement (TCAG → CUGA) to give the mRNA.

pprint — Data pretty printer — Python 3.11.4 documentation

The pprint module provides a capability to “pretty-print” arbitrary Python data ... with their keys sorted, otherwise they will display in insertion order....

test Documentation

Dealing with large search output files with indexing . ... operations on sequences, such as translation, transcription and weight calcula-.