Length of the inserted/deleted sequence does not match SVLEN – why?
See original GitHub issueI just noticed that the length of the deleted (in REF column of the output VCF) or inserted (in ALT column) does not always match the SVLEN. I cannot explain this. What am I missing?
Or in other words – how is the SVLEN calculated if not from the length of the inserted/deleted sequence?
Here is an example
chr20 4699380 0 N GGTGGTGGCAGGGCGGCCTCATGGTGGTGGCTGGGGGCAGCCTCAT . STRANDBIAS PRECISE;SVMETHOD=Snifflesv1.0.12;CHR2=chr20;END=4699404;STD_quant_start=3.558142;STD_quant_stop=7.716681;Kurtosis_quant_start=1.043092;Kurtosis_quant_stop=1.528971;SVTYPE=INS;SUPTYPE=AL;SVLEN=21;STRANDS=+-;STRANDS2=37,69,37,69;RE=106;REF_strand=6462,6730;Strandbias_pval=0.00447258;AF=0.00803517 GT:DR:DV 0/0:13086:106
SVLEN is +21, but length of the inserted sequence (GGT…CAT) is 46 bp.
I had a look at the previous questions but didn’t find anything about this. Feel free to link me if I missed it.
Issue Analytics
- State:
- Created 2 years ago
- Comments:8 (3 by maintainers)
Top Results From Across the Web
Use the inserted and deleted tables - Microsoft Learn
Complex expressions can reference multiple columns, yet the inserted and deleted tables have only one value for each inserted row.
Read more >StructuralVariantAnnotation Quick Overview - Bioconductor
Introduction. This vignette outlines parsing and annotation of structural variants from Variant Call Format (VCF) using the ...
Read more >Basic SQL: All about sequences - svenweller - WordPress.com
The application code that does the insert does not need to bother with the name of the sequence. The trigger fires once FOR...
Read more >The Variant Call Format (VCF) Version 4.2 Specification
The 'Flag' type indicates that the INFO field does not contain a Value entry, and hence the ... a t CAg a A...
Read more >Detecting high-scoring local alignments in pangenome graphs
While sequence-to-graph mapping to graphical pangenomes has been studied for some time, no local alignment search tool in the vein of BLAST has...
Read more >
Top Related Medium Post
No results found
Top Related StackOverflow Question
No results found
Troubleshoot Live Code
Lightrun enables developers to add logs, metrics and snapshots to live code - no restarts or redeploys required.
Start Free
Top Related Reddit Thread
No results found
Top Related Hackernoon Post
No results found
Top Related Tweet
No results found
Top Related Dev.to Post
No results found
Top Related Hashnode Post
No results found

We looked at this pretty carefully in the Jasmine paper and found -d 50 to be pretty much ideal (Especially Figure 2e): https://www.biorxiv.org/content/10.1101/2021.05.27.445886v1
Cheers
Mike
On Wed, Jul 7, 2021 at 1:10 PM Fritz Sedlazeck @.***> wrote:
Brilliant. Thank you very much both